A: RNA-seq

High rRNA contaminations: Ribosomal RNA Depletion did not worked well.
Few adapters: Remove them for assemblies

bbduk.sh -in=example_A.fq.gz -out=example_A_trim.fq.gz trimq=15 literal=AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT ktrim=r k=11 mink=11

B: DNA-Seq (Host parasite system)

Adapters: remove them
Extremely low GC content -> species specific
Few reads are contaminates (GC peak is not so sharp)

 bbduk.sh -in=example_B.fq.gz -out=example_B_trim.fq.gz qtrim=rl trimq=15 literal=AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT ktrim=r k=11 mink=11 minlength=100

C: RAD-Seq

Few adapters: Remove them
Restriction site produce over-representation of bases
Low quality at the restriction site: not a problem

bbduk.sh -in=example_C.fq.gz -out=example_C_trim.fq.gz qtrim=rl trimq=15 literal=AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT ktrim=r k=11 mink=11 minlength=100

D: Ampli-Seq

Many small reads: filtering needed

bbduk.sh -in=example_D.fq.gz -out=example_D_trim.fq.gz qtrim=rl trimq=15 minlength=100

E: Ampli-Seq

Many low quality bases: trimming and filtering needed
Problem with the sequencing run

bbduk.sh -in=example_E.fq.gz -out=example_E_trim.fq.gz qtrim=rl trimq=15 minlength=50

F: DNA-Seq

Few adapters : trim and filtering needed
Strange GC peak: will be remove when you are removing the adapters.

bbduk.sh -in=example_F.fq.gz -out=example_F_trim.fq.gz qtrim=rl trimq=15 literal=GATCGGAAGAGCACACGTCTGAACTCCAGTCACACAGTGATCTCGTATGCC

G: ONT data

Good run
No filtering needed

H: Metagenome data

Wide GC peak: Expected if you have species with different GC contents.
Remove low complexity reads for assemblies

I: 10X data

Internal barcode at the beginning of the sequence: will be removed by the tools later
Quality not too bad for 10X data reverse

J: DNA-seq

PolyG tail: trimming and filtering maybe needed

bbduk.sh -in=example_J.fq.gz -out=example_J_trim.fq.gz qtrim=rl trimq=15 literal=GGGGGGGGGGGGGGGGGGGGGGG minlength=100