Skip to content

GDC - Project Support Page

  • Project : p463
  • Locus : 12S (ribosomal RNAs)
  • Aim : Compare Mifish and Teleo primers
  • Results : Summary

Locus Information

The 12S ribosomal RNA varies in length between 819 bp (Xenopus laevis) and 958 bp (Cebus albifrons and Tarsius bancanus).

Test Primer Sets

MiFish-Primer

>MiFish-U-F
GTCGGTAAAACTCGTGCCAGC
>MiFish-U-R
CATAGTGGGGTATCTAATCCCAGTTTG

Ref: Mia at al. (2015) MiFish, a set of universal PCR primers for metabarcoding environmental DNA from fishes: detection of more than 230 subtropical marine species. The Royal Society.

Teleo-Primer

>Teleo-F
ACACCGCCCGTCACTCT
>Teleo-R
CTTCCGGTACACTTACCATG

Ref: Valentini et al. (2016) Next‐generation monitoring of aquatic biodiversity using environmental DNA metabarcoding. Molecular Ecology.

Amplicon Location & Size

           100 200 300 400 500 600 700 800 900 1000 (12S size range: 800-960nt, Yang et al. (2014))
           |   |   |   |   |   |   |   |   |   |
 Teleo     |   |   |   |   |   |   |   | ==|=  |  > Size:  63nt (±9.40) Thang et al. (2020)
 MiFish-U  |   | ==|===|=  |   |   |   |   |   |  > Size: 171nt (±5.67) Thang et al. (2020)
           |   |   |   |   |   |   |   |   |   |

For a better overview see: https://besjournals.onlinelibrary.wiley.com/doi/10.1111/2041-210X.13485

Class Tax-IDs for Fish

# superclass: Actinopterygii (NCBI TaxID: 7898)
#          ⊢ class: Actinopteri (NCBI TaxID: 186623)
#          ⊢ class: Cladistia (NCBI TaxID: 1338366)

# class: Chondrichthyes (NCBI TaxID: 7777)

Design

First PCR

  • first PCR with MiFish-U forward and Teleo reverse
  • both amplicons are on the same 12S fragment > same annotation
  • max 3 mismatches per primer site
            100 200 300 400 500 600 700 800 900 1000
            |   |   |   |   |   |   |   |   |   |
 Teleo      |   |   |   |   |   |   |   | ==|=  |  
 MiFish-U   |   | ==|===|=  |   |   |   |   |   |  
            |   |   |   |   |   |   |   |   |   |
 Teleo-R    |   |   |   |   |   |   |   |   |⥞  |  
 MiFish-U-F |   | ⇀ |   |   |   |   |   |   |   |  
                  <---------- 720nt ---------->

Second PCR

  • template: first PCR amplicon
  • range of 0-3 mismatches per primer site
  • no mismatches at the 3`-end
            100 200 300 400 500 600 700 800 900 1000
 #1PCR      |   | ==|===|===|===|===|===|===|=  |
 Teleo      |   |   |   |   |   |   |   | ==|=  |   > expected length:  63nt 
 MiFish-U   |   | ==|===|=  |   |   |   |   |   |   > expected length: 171nt

Application(s)

* usearch (v11.0.667_i86linux64)
* emboss (6.5.7)