Skip to content

Long-Read vs. Short-Read Sequencing for 16S Amplicon Studies

Overview

This page discusses the tradeoffs between long read (PacBio) and extended short read (Illumina MiSeq i100) technologies for 16S rRNA amplicon sequencing in complex microbial communities. The goal is to help choose the amplicon length and platform combination that maximises taxonomic resolution relative to sequencing cost while maintaining data quality.

Background: Why Standard Short-Read 16S May Fall Short

Standard short-read 16S sequencing (e.g. 2×250bp on MiSeq, covering V3-V4) is well-established, cost-effective, and widely benchmarked. However, for studies targeting fine-scale compositional differences between complex communities, short amplicons covering only one or two hypervariable regions may not provide sufficient phylogenetic signal to discriminate closely related taxa.

The natural next step is to consider longer amplicons, either via full-length 16S on PacBio or via extended-amplicon Illumina sequencing. Each approach comes with distinct tradeoffs, detailed below.


Key Considerations

Taxonomic Resolution: The Ceiling Is Biological, Not Technical

Longer 16S amplicons improve species-level discrimination relative to short hypervariable-region amplicons, but this improvement has a hard biological ceiling that no sequencing technology can overcome.

Full-length 16S does not guarantee species resolution

Certain clades show high 16S conservation regardless of the region sequenced. The most well-known example is Escherichia/Shigella, which are nearly indistinguishable by 16S alone. For lineages where 16S resolution is inherently insufficient, orthogonal functional marker genes should be considered (see Beyond 16S).

The marginal taxonomic gain from extending an amplicon from ~900bp (V1-V5) to ~1500bp (full-length) is considerably smaller than the gain from ~250bp (V3-V4) to ~900bp. Combined with the data quality costs of very long amplicons (see below), the case for full-length sequencing weakens for diverse community profiling.


Reference Database Coverage

In practice, the majority of 16S records in databases such as SILVA and GTDB are partial sequences derived from short-read amplicon studies. Full-length reference sequences are therefore underrepresented, meaning that classifying a full-length query sequence often requires matching against entries that only partially overlap it. This can reduce classification confidence and increase the rate of ambiguous or genus level only assignments, the opposite of what one might expect from a longer, more informative query.

A well-designed 900bp V1-V5 amplicon will in many cases align more completely and confidently to available references than a 1500bp full-length sequence, while avoiding the additional complications introduced by very long reads.


Chimera Formation Scales with Amplicon Length

Chimera formation during PCR is one of the strongest arguments against full-length 16S for highly diverse samples.

Chimera risk in complex communities

Chimera frequency increases with amplicon length for two reasons. First, more conserved priming sites are available for mispriming during PCR. Second, longer molecules are more likely to form hybrid templates during denaturation and annealing. In highly diverse samples, organisms sharing nearly identical conserved regions but divergent variable regions are common, exactly the condition that promotes chimera formation.

Chimera detection tools such as UCHIME and vsearch become less reliable when the sample itself contains many genuinely divergent sequences that superficially resemble chimeras, leading to artifactual inflation of OTU/ASV counts.


Sequencing Depth and Cost Efficiency

High community diversity demands high sequencing depth. For confident detection of low-abundance taxa in a complex microbiome, you typically need 50,000–100,000+ high-quality reads per sample. This has direct implications for platform choice.

Read Depth Is Not Cell Count

"Confident detection" here means confident detection in the read data, which isn't quite the same as confident detection of organisms. 16S rRNA gene copy number varies substantially between taxa (1 to 15+ copies per genome), so read counts systematically over- or underrepresent true relative abundance depending on which taxa you're comparing, regardless of how much depth you throw at the problem. See Primer Design for the full explanation and what correction options exist.

Strengths

Full-length amplicons (~1500bp) are captured in a single pass with excellent per-read accuracy (~Q30+ for CCS reads). PacBio is well-suited for lower-diversity targets such as 12S fish eDNA or ITS fungal amplicons, where the per-sample read budget is adequate for the expected diversity.

Limitations for high-diversity 16S

Per-read cost is substantially higher than Illumina. Total read output per run limits per-sample depth when barcoding many samples simultaneously, which is a critical constraint for highly diverse communities. Kinnex increases throughput by concatenating multiple amplicons per SMRT read, but subread depth per molecule decreases accordingly, reducing CCS accuracy particularly for the flanking molecules in the concatenated array. For communities with hundreds to thousands of expected ASVs, a single PacBio Revio run may not yield sufficient reads per sample for robust diversity estimates. Heteroduplex formation is a further, separate concern for allele-level resolution on Revio specifically, see Insights & Solutions for the mechanism and what to do about it.

Strengths

Higher read output per sequencing dollar compared to PacBio for amplicon work. Extended reads (~850–900bp) enable V1-V5 coverage with paired-end merging and overlap. The error profiles are well-characterised and compatible with established DADA2 / VSEARCH pipelines. Better sensitivity for rare taxa is achieved through sequencing depth, and chimera rates are more manageable than for full-length approaches.

Limitations

Merged reads at ~850bp approach the limits of reliable quality in regions of thin R1/R2 overlap, making careful trimming and quality filtering essential. Illumina substitution errors (particularly at read ends) differ from PacBio error profiles and must be accounted for in analysis. Full-length 16S coverage (~1500bp) is not achievable with this platform.

Recommended platform for diverse communities

For broad compositional comparison across highly diverse samples, the depth and cost advantages of Illumina MiSeq i100 (~850–900bp amplicon) outweigh the modest resolution gain of full-length PacBio reads. PacBio long-read amplicon sequencing remains the preferred choice for lower-diversity targets or for resolving specific closely related lineages after an initial screen.


Primer Recommendations for ~850–900bp V1-V5 Amplicons

For highly diverse environmental communities, a well-placed primer pair spanning V1 through V5 (~850–900bp) on MiSeq i100 offers the best balance between taxonomic resolution, sequencing depth, and data quality. The table below summarises the most commonly used options. See Primer Design for the general principles (degeneracy, 3' end protection, nontarget coamplification) behind these specific recommendations.

Primer pair Forward primer (5'→3') Reverse primer (5'→3') Approx. size Notes
27F-YM / 926R AGAGTTTGATYMTGGCTCAG CCGYCAATTYMTTTRAGTTT ~900bp Recommended for diverse communities; extended degeneracy improves coverage of Actinobacteriota, Planctomycetes, and Verrucomicrobia
27F / 907R AGAGTTTGATCMTGGCTCAG CCGTCAATTCMTTTRAGTTT ~880bp Most widely cited pair for this amplicon length; good choice when cross-study comparability is a priority
63F / 926R CAGGCCTAACACATGCAAGTC CCGYCAATTYMTTTRAGTTT ~865bp Improved coverage of Nitrospira compared to 27F variants; preferred when nitrifying community structure is a primary question

Choosing Between Primer Pairs

27F-YM / 926R is the recommended default for novel studies targeting diverse microbial communities. The additional degeneracies in both primers improve amplification of phylogenetically divergent lineages without meaningfully increasing amplicon size relative to the classic 27F/907R pair.

27F / 907R remains a solid choice when comparability with a large body of existing literature is important, for example when re-analysing communities alongside published environmental datasets.

63F / 926R should be considered when specific lineages poorly covered by 27F variants (most notably Nitrospira) are of central interest. The 63F forward primer shifts the amplicon slightly to better encompass the V1 region in these organisms, at the cost of slightly less extensive benchmarking in broad community surveys.

Degeneracy codes

M = A/C · Y = C/T · R = A/G · W = A/T. These degenerate positions allow a single primer to amplify a broader range of template sequences and are essential for achieving even taxonomic coverage in complex communities.


Beyond 16S: Functional Marker Genes

When the research question requires discrimination below the resolution limit of 16S, complementing community profiling with orthogonal functional marker genes is more effective than attempting to extract additional resolution from a longer 16S amplicon. The choice of marker depends on the lineages of interest.

Target group Recommended marker Rationale
Polyphosphate-accumulating organisms (Ca. Accumulibacter) ppk1, phoU Strain-level resolution of PAO phylotypes inaccessible by 16S
Nitrifying bacteria / comammox Nitrospira nxrB Resolves comammox from canonical nitrite-oxidising lineages
Ammonia-oxidising bacteria and archaea amoA Functional and phylogenetic resolution beyond 16S for AOB and AOA
Sulfate-reducing bacteria dsrB Discriminates ecologically distinct SRB lineages with conserved 16S
Methanogens mcrA Resolves methanogenic archaeal diversity more reliably than 16S

Summary

The decision tree below summarises the recommended approach for amplicon-based community profiling.

Short reads (V3-V4, ~250bp)
  May be insufficient for fine-scale diversity comparisons in complex communities

Full-length 16S on PacBio (~1500bp)
  Better resolution, but biological ceiling remains
  High chimera risk in diverse samples
  Lower sequencing depth per sample per dollar
  Kinnex helps throughput but reduces per-read accuracy
    → Preferred for low-diversity targets (12S, ITS) or targeted lineage resolution

Extended amplicon on MiSeq i100 (~850-900bp, V1-V5)
  Most informative V-region combination for broad bacterial diversity
  Better depth and cost efficiency than PacBio
  Manageable chimera rates
  Recommended primer pair: 27F-YM / 926R
    → Preferred for diverse community profiling